Laboratory Chemicals > Product Information > E > EpiSight > Leaflet of EpiSight



Bisulfite Conversion Kit
BisulTaq DNA Polymerase
PDF File (675 KB/4 page)
EpiSight Bisulfite Conversion Kit (Wako Cat. No. 297-71901) offers a fast and efficient alternative to traditional bisulfite conversion. The protocol is optimized to minimize reagent preparation and bisulfite conversion time. This kit contains Enhancer for bisulfite conversion to allow the enhancement of the bisulfite conversion efficiency and inhibit of DNA degradation.

Subsequent PCR-amplification using EpiSight BisulTaq DNA Polymerase*1, recombinant, Solution (Wako Cat. No. 297-72001) is more efficient compared to using conventional Taq DNA polymerase.



Product Name Package Size Wako Cat. No.
EpiSight Bisulfite Conversion Kit 20 tests 297-71901
EpiSight BisulTaq Polymerase, recombinant, Solution*1 100 units 297-72001
*1: Hot-Start Gene Taq NT (Nippon Gene) (Wako Cat. #311-07523 (250 units) is also recommended, depending on DNA samples.


*2: The condition should be optimized depending on cell line, length of the template DNA and GC content.
In case that the template DNA is more than 500 bp, follow the above mentioned standard protocol.
In case that you got insufficient amplified products or insufficient conversion from cytosine to uracil, incubate at 95°C for 1 min. and then 60°C for 30 min. for 32 cycles.

*1: Hot-Start Gene Taq NT (Nippon Gene) (Wako Cat. #311-07523 (250 units) is also recommended, depending on DNA samples.
These kits do not include reagents for DNA cloning & sequencing.

Bisulfite reaction at 95°C for 2 hours generally has a property of enhancing mC → conversion reaction as well as C→U.

Enhancer provided in EpiSight Bisulfite Conversion Kit achieved the ideal conversion reaction such as enhancement of C→U conversion reaction and inhibition of mC→T conversion reaction.









Start point of transcription: 169

Forward primer: 27 mer
Primer before bisulfite conversion:
GGTTGGGGTCTCTCCAGGTGACAGTAG
Primer after bisulfite conversion:
GGTTGGGGTTTTTTTAGGTGATAGTAG
Reverse primer: 30 mer
Primer before bisulfite conversion:
CCTTTTGAGGCCCAGCAGGTAGTCCCCTGC
Primer after bisulfite conversion:
CCTTTTAAAACCCAACA AATAATCCCCTAC

Bisulfite treatment with this kit achieved subsequent amplification of Fgf4 promoter region at the 1st PCR.






Q: What is DNA methylation?
A: In case of eucaryotes, it is methylation of carbon at the 5 position of cytosine (C). The transcription factor cannot bind to methylated DNA region and gene expression is inactivated.

Q: What is Bisulfite Reaction?
A: It is a reaction in which cytosine (C) is converted to uracil (U) by sodium bisulfite. As methylated cytosine is not converted to uracil (U), methylation of DNA is analyzed utilizing this difference.

Q: What do ○ and ● in data show?
A: ○ shows thymine (T) and ● shows cytosine (C). In other words, ○ is the region of non-methylated cytosine and ● is that of methylated cytosine before bisulfite reaction. The line number presents each plasmid clone and the row number presents the cytosine (C) number designated in advance.

Q: What is the most notable feature of EpiSight Bisulfite Conversion Kit?
A: It is high conversion rate of cytosine (C) to uracil (U).

Q: What is your recommendable kit to prepare genomic DNA?
A: As extraction kits of genome DNA, QuickGene SP kit DNA tissue (96 tests; Cat. No. 632-23629)*3, QuickGene DNA tissue kit S (96 tests; Cat. No. 637-23559)*3.
In addition, DNA extraction kits using general-purpose columns.
   *3: It is available in Europe, only.

Q: Why is Taq DNA Polymerase sold separately?
A: Because there is a patent.

Q: Why is the reaction time shortened?
A: Because Enhancer promotes the Bisulfite reaction.

Q: Is it possible that the reaction time is shorter than 2 hours?
A: The shortest reaction time is around 90 minutes although It depends on the genomic DNA.

Q: I worry about the reaction at 95°C. Do you have any other reaction under a mild condition?
A: We confirmed the Bisulfite reaction at 55°C for 16 hours reduced the conversion efficiency.

Q: Does the high-temperature reaction have negative effects for my samples?
A: Please refer to the above mentioned "Q: I worry about the reaction at 95°C. Do you have any other reaction under a mild condition?"

Q: What is Enhancer?
A: The composition is proprietary. It is a catalyst used in the Bisulfite reaction.

Q: Is it OK to react other competitor's kits at such hightemperature?
A: Follow the protocol of the kit.
Q: Can any Taq DNA Polymerase be used?
A: Use EpiSight BisulTaq DNA Polymerase (Cat. #297-72001).
It is the DNA polymerase optimized to PCR after bisulfite reaction. Use of α-type DNA polymerase is not recommended.

Q: Can I keep the bisulfite treated DNA sample?
A: You can keep it below -20°C for 2 weeks. However, the bisulfite-treated genomic DNA is unstable. Please use up the samples as soon as possible.

Q: What does 5-hydroxymethyl cytosine (5-hmC) become after the reaction?
A: It is not converted to uracil similarly to 5-mC. This kit cannot distinguish 5-hmC and 5-mC.

Q: Can the DNA samples treated with this kit be used in the next generation sequencing?
A: Yes, they can.

Q: Can a column be used as the purification of the bisulfite treated DNA instead of DNA Cleaner?
A: Yes, you can purify it using an appropriate column.

Q: What is the recommendable control DNA?
A: Totally methylated DNAs (e.g.: mouse M1 cell-derived DNA) and non-methylated DNAs (e.g.: mouse ES cellderived DNA, cloned plasmid DNA) are recommended as controls to confirm proper conduct of bisulfite reaction.

Q: To what points should we pay attention to primer designing?
A: Pay your attention to the following points:
1. Design forward primers from the sequence converted from cytosine (C) to thymine (T).
2. Design taking care to prevent bias in base sequence at Tm of 62°C and higher.
3. Design the PCR products which is 400 bp or less.
Tm: Melting temperature at which a half of double-stranded DNAs divided into single-stranded DNAs.

Q: How many conversion kits do 100 units of EpiSight BisulTaq DNA Polymerase (Wako Cat. No. 297-72001) correspond to?
A: Roughly 2 to 4 kits depending on the method of use.

Q: What is "DNA Cleaner", a kit content of EpiSight Bisulfite Conversion Kit ?
A: It is a polymer solution to remove low molecular DNA.

Q: To what length can DNA be amplified by PCR?
A: Assuming that cytosines in a template DNA are "completely converted", amplification to approximately 600 bp has been confirmed by PCR.


Wako Pure Chemical Ind., Ltd.
www.wako-chem.co.jp

1-2 Doshomachi 3-Chome, Chuo-ku
Osaka 540-8605 Japan
Tel: +81-6-6203-3741/Fax: +81-6-6203-1999
Online Catalog: www.e-reagent.com
Wako Chemicals USA, Inc.
www.wakousa.com

Toll-Free (U.S.only): Tel: +1-877-714-1920
Head Office (VA) Tel: +1-804-714-1920
Los Angeles Sales Office (CA): Tel: +1-949-679-1700
Boston Sales Office (MA): Tel: +1-617-354-6772
Wako Chemicals GmbH
<Europe Office>
www.wako-chemicals.de

Neuss, Germany
Tel: +49-2131-311-0
Fax: +49-2131-311100